الخميس، 30 أبريل 2020
الاثنين، 27 أبريل 2020
السبت، 25 أبريل 2020
الخميس، 23 أبريل 2020
الاثنين، 20 أبريل 2020
الأحد، 19 أبريل 2020
السبت، 18 أبريل 2020
الأربعاء، 15 أبريل 2020
الثلاثاء، 14 أبريل 2020
الاثنين، 13 أبريل 2020
الأحد، 12 أبريل 2020
السبت، 11 أبريل 2020
الخميس، 9 أبريل 2020
الثلاثاء، 7 أبريل 2020
الأحد، 5 أبريل 2020
أخبار سيئة
بخصوص البروتين الملفوف داخل جينوم فيروس كورونا تبعا لجريدة نيويورك تايمز الامريكية
Bad News Wrapped in Protein: Inside the Coronavirus Genome
----------------------------------------------------------------------------------------
A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.
In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.
Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.
-------------------------------------------------------------------------------------
A String of RNA:- (أينشتاين مصر)
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.
--------------------------------------------------------------------------------------
The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.
The first sequence of RNA letters reads:
auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag
This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.
----------------------------------------------------------------------------------------
The full coronavirus genome and the proteins it encodes are shown below.
A Chain of Proteins · ORF1ab
The first viral protein created inside the infected cell is actually a chain of 16 proteins joined together. Two of these proteins act like scissors, snipping the links between the different proteins and freeing them to do their jobs.
--------------------------------------------------------------------------------------
You can continue reading on the link below
السبت، 4 أبريل 2020
الجمعة، 3 أبريل 2020
الأربعاء، 1 أبريل 2020
الاشتراك في:
الرسائل (Atom)
سمعت مقولة بتقول لو عاوز تستثمر واستثمارك يتنجح استمثر في المكياج او في المطاعم فالناس مش هتبطل تاكل ولا الستات هيبطلوا يحطوا مكياج 😂 ففي ...
-
قسم نظم ومعلومات حيوية bioinformatics اولا: هنتعرف علي القسم وايه الفرق بينه وبين اقسام حاسبات عام ثانيا: هنتعرف علي الشغل وسوق الع...

